cd9a

Ensembl ID:
ENSDARG00000005842
ZFIN ID:
ZDB-GENE-030131-1175
Description:
CD9 antigen [Source:RefSeq peptide;Acc:NP_997784]
Human Orthologue:
CD9
Human Description:
CD9 molecule [Source:HGNC Symbol;Acc:1709]
Mouse Orthologue:
Cd9
Mouse Description:
CD9 antigen Gene [Source:MGI Symbol;Acc:MGI:88348]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6498 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019571 Essential Splice Site 89 227 None 8
ENSDART00000135587 Essential Splice Site 90 228 None 8

The following transcripts of ENSDARG00000005842 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 6217877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCGGATGTTGCGGAGCCATCCAGGAGTCCCCTTGCATGCTGGGATTGG[T/C]AATGCACATATYATGCAGCTTGTAATATCTGTATATACARTTGAAGTCAR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8tdiu00g