anapc2

Ensembl ID:
ENSDARG00000005832
ZFIN ID:
ZDB-GENE-081104-256
Description:
Novel protein similar to vertebrate anaphase promoting complex subunit 2 (ANAPC2) [Source:UniProtKB/
Human Orthologue:
ANAPC2
Human Description:
anaphase promoting complex subunit 2 [Source:HGNC Symbol;Acc:19989]
Mouse Orthologue:
Anapc2
Mouse Description:
anaphase promoting complex subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2139135]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13633 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027796 Nonsense 183 781 3 15
ENSDART00000133722 Nonsense 191 802 3 14
Genomic Location:
Chromosome 5 (position 62888954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAGGCTGAGGAGGGAGCCRTTGATACTGATGAAGGTGGTTTGTGCT[C/A]GGGCTGTGCCACCCTCCCTCACCTGTGCTGGTGTCAGGAAGCTCTACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/givenmcp