LOC556578

Ensembl ID:
ENSDARG00000005800
Human Orthologue:
AMPD3
Human Description:
adenosine monophosphate deaminase 3 [Source:HGNC Symbol;Acc:470]
Mouse Orthologue:
Ampd3
Mouse Description:
adenosine monophosphate deaminase 3 Gene [Source:MGI Symbol;Acc:MGI:1096344]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa523 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003612 Essential Splice Site 82 765 2 15
Genomic Location:
Chromosome 7 (position 68757174)
KASP Assay ID:
554-0353.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTACTCAGAGAACTGGCTGAGCAACAGTCAGAAGAAAGTGCCAAACGG[T/C]CAGCACCATTCGGCAACATCGGTCCTGAAGGGCCACTGTCCTGCAGAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z3krb3bb