rpl28l

Ensembl ID:
ENSDARG00000005791
ZFIN ID:
ZDB-GENE-040930-10
Description:
60S ribosomal protein L28 [Source:RefSeq peptide;Acc:NP_957355]
Human Orthologue:
RPL28
Human Description:
ribosomal protein L28 [Source:HGNC Symbol;Acc:10330]
Mouse Orthologues:
AC155646.1, Rpl28
Mouse Description:
ribosomal protein L28 Gene [Source:MGI Symbol;Acc:MGI:101839]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12430 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012055 Essential Splice Site None 138 1 5
Genomic Location:
Chromosome 16 (position 55539592)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGAACTGGAACTCCTTCCTTTCCCTCTCTCTTCCTCTGCACAGAAGG[T/C]AACGTGGTCGWCTTGTGTAGCTTTTTAGCGACCGAATAAACTCGTTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jjha8o21