enpp1

Ensembl ID:
ENSDARG00000005789
ZFIN ID:
ZDB-GENE-040724-172
Description:
ectonucleotide pyrophosphatase/phosphodiesterase family member 1 [Source:RefSeq peptide;Acc:NP_0010
Human Orthologue:
ENPP1
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 1 [Source:HGNC Symbol;Acc:3356]
Mouse Orthologue:
Enpp1
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 1 Gene [Source:MGI Symbol;Acc:MGI:97370]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12823 Essential Splice Site Available for shipment Available now
sa17193 Essential Splice Site Available for shipment Available now
sa3099 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6620 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11561 Essential Splice Site Available for shipment Available now
sa156 Nonsense F2 line generated During 2014
sa23648 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16086 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Essential Splice Site 43 878 1 25
ENSDART00000127350 Essential Splice Site 43 876 1 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13318235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACAACACTGCAAAAGTCCAGTCAAGATACYTGAAAATCCTCTGTGCG[G/A]TAAGCGGACACTCNTCGGGGAAACAAAAGCCGGTTACTGAATCTARGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Essential Splice Site 43 878 None 25
ENSDART00000127350 Essential Splice Site 43 876 None 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13318236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAACACTGCAAAAGTCCAGTCAAGATACYTGAAAATCCTCTGTGCGR[T/C]AAGCGGACACTCNTCGGGGAAACAAAAGCCGGTTACTGAATCTARGTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Essential Splice Site 153 878 4 25
ENSDART00000127350 Essential Splice Site 153 876 4 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13340666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGAAAGTGGGAGACTGCTGTGCAAACTATAAGAGGACATGTGAAGG[T/C]ACATCACAGGCTTCAATCCTCTGTTTATATATTAACTGTCAGTAATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Essential Splice Site 355 878 11 25
ENSDART00000127350 Essential Splice Site 355 876 11 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13362098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAGAGCCAGATGCATCAGGACWCAAATATGGACCAATGAGTACCCAGG[T/G]AAWCTAAAAAAGGAAAATAATTGTTAAACTTAAATATTTGCTTAGNTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Essential Splice Site 392 878 12 25
ENSDART00000127350 Essential Splice Site 392 876 12 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13366101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGAAATCTGCACAAATGTGTCAAYGTGRTTCTTGTATCAGACCACGG[T/A]GAGTACAGCATTGCATTTTCAAGWKTAACTTTAATGGTAAATAATAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa156
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Nonsense 427 878 13 25
ENSDART00000127350 Nonsense 427 876 13 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13377632)
KASP Assay ID:
554-0017.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCAATGACATCACTGTGATCCAGGGTCCTGCCGCGAGAGTCCGACCR[C/T]GACACGTGCCTGAGGAGTTCTTCTCCTGTACGTGCACAGATTTAACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Essential Splice Site 489 878 None 25
ENSDART00000127350 Essential Splice Site 489 876 None 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13378347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTGAGAGAGCACATCTGTACATGCAGCCGCAGTGGCAAGCAGCACTG[T/C]GAGTTTTATTATTCTTGTGTCAAAATATATGTTAAGTTCATTGATTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045183 Essential Splice Site 780 878 24 25
ENSDART00000127350 Essential Splice Site 778 876 24 25

The following transcripts of ENSDARG00000005789 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13432613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTACTTGGCAACAAATAAGCAGATGCAGATGRTTGTCCTCTACTTTC[A/G]GGAATGGAGCACCGATTCCTACACATTTCTTTATTATTCTTACAAGCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xh6qjg1d