ppm1f

Ensembl ID:
ENSDARG00000005786
ZFIN ID:
ZDB-GENE-051128-2
Description:
Novel protein similar to vertebrate protein phosphatase 1F (PP2C domain containing) (PPM1F) [Source:
Human Orthologue:
PPM1F
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1F [Source:HGNC Symbol;Acc:19388]
Mouse Orthologue:
Ppm1f
Mouse Description:
protein phosphatase 1F (PP2C domain containing) Gene [Source:MGI Symbol;Acc:MGI:1918464]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40367 Nonsense Mutation detected in F1 DNA During 2017
sa10555 Nonsense Available for shipment Available now
sa15162 Nonsense Available for shipment Available now
sa15839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051666 Nonsense 46 424 1 7
Genomic Location (Zv9):
Chromosome 5 (position 14404402)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12701839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGCCAGTCAGTTCAGCGAACCGAATCATCTCTCTGCAGGAGCTGAAG[G/T]GAGAAAGTCTGGATTTAGGCCTCCGACTGCTTTCAGCCAGGTTAGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051666 Nonsense 127 424 3 7
Genomic Location (Zv9):
Chromosome 5 (position 14396495)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12693932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRTCTCTTCATTAATAAATTGAGAGCRGTGGGTGTGGCCTGGCAGAAA[C/T]AGCCGCCYAAWCCCGATGCTCCCTCTTCGCGCACACACAGCTGCTCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051666 Nonsense 178 424 4 7
Genomic Location (Zv9):
Chromosome 5 (position 14395882)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12693319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATCACTTTTTTTTTNCTCTCTCCAGGATGGTGTGGGTAGAGAGTATTA[T/A]GCTGTGTTTGATGGGCATGGAGGAGTAGAMGCTGCCACTTACAGTGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051666 Nonsense 260 424 5 7
Genomic Location (Zv9):
Chromosome 5 (position 14389347)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12686784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTTTACTGACCTCTGACCTCCTYACCGTGTCYTGGCTGGGCGATTCC[C/T]AAGCTCTGCTRGTCCGCCAGGGGGAACCAGTGAYCCTAATGGMCCCCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link