elovl7b

Ensembl ID:
ENSDARG00000005785
ZFIN ID:
ZDB-GENE-030131-5485
Description:
elongation of very long chain fatty acids protein 7 [Source:RefSeq peptide;Acc:NP_956072]
Human Orthologue:
ELOVL7
Human Description:
ELOVL family member 7, elongation of long chain fatty acids (yeast) [Source:HGNC Symbol;Acc:26292]
Mouse Orthologue:
Elovl7
Mouse Description:
ELOVL family member 7, elongation of long chain fatty acids (yeast) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34994 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014385 Nonsense 28 282 2 8
Genomic Location (Zv9):
Chromosome 10 (position 46574029)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150589.1 5225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTGTGTGTGTGTGTGTGTGTGTTTCTCAGATCCGCGCACAGGGAACT[G/A]GCTCCTCATGGGTTCCCCGTTCCCGCAGACGTTCATCATCGCCGCTTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link