ncanb

Ensembl ID:
ENSDARG00000005783
ZFIN ID:
ZDB-GENE-050208-586
Description:
Novel protein similar to vertebrate chondroitin sulfate proteoglycan family (CSPG) [Source:UniProtKB
Human Orthologues:
ACAN, BCAN, NCAN, VCAN
Human Descriptions:
aggrecan [Source:HGNC Symbol;Acc:319]
brevican [Source:HGNC Symbol;Acc:23059]
neurocan [Source:HGNC Symbol;Acc:2465]
versican [Source:HGNC Symbol;Acc:2464]
Mouse Orthologues:
Acan, Bcan, Ncan, Vcan
Mouse Descriptions:
aggrecan Gene [Source:MGI Symbol;Acc:MGI:99602]
brevican Gene [Source:MGI Symbol;Acc:MGI:1096385]
neurocan Gene [Source:MGI Symbol;Acc:MGI:104694]
versican Gene [Source:MGI Symbol;Acc:MGI:102889]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18086 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005724 Essential Splice Site 1054 1268 28 33
ENSDART00000135716 Essential Splice Site 76 309 2 7
ENSDART00000141563   None 320 None 4
Genomic Location (Zv9):
Chromosome 22 (position 18137384)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17888319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGYGTGTCTGTGTTTGCCCAGTTATGGAGGAGCCACTTGTGAGAAAG[G/T]TAATGCAATAACACATGCACACTTATGGCCTAATGAAGTAATAATTAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association study identifies genetic variation in neurocan as a susceptibility factor for bipolar disorder. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Major depressive disorder: Genome-wide association study of major recurrent depression in the U.K. population. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link