npy8br

Ensembl ID:
ENSDARG00000005780
ZFIN ID:
ZDB-GENE-980526-208
Description:
neuropeptide Y receptor Y8b [Source:RefSeq peptide;Acc:NP_571511]
Human Orthologue:
PPYR1
Human Description:
pancreatic polypeptide receptor 1 [Source:HGNC Symbol;Acc:9329]
Mouse Orthologue:
Ppyr1
Mouse Description:
pancreatic polypeptide receptor 1 Gene [Source:MGI Symbol;Acc:MGI:105374]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31687 Nonsense Available for shipment Available now
sa12108 Nonsense Available for shipment Available now
sa17517 Nonsense Available for shipment Available now
sa11187 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015833 Nonsense 239 375 1 1
Genomic Location (Zv9):
Chromosome 8 (position 53913328)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51648687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTACGCCTCAGTCGACGTAAAGATATGGTTGAAAGGGCTCGCGGAGGA[C/T]GACAGAAGAAAGCCAAAGGCTCAAAGCGAGTGAACGCCATGCTGGCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015833 Nonsense 300 375 1 1
Genomic Location (Zv9):
Chromosome 8 (position 53913144)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51648503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCAGCACGACGCTATTTTCTCAGCTTGYCACCTCACTGCTATGGCCT[C/A]GACATGCGTCAATCCGGTCATCTACGGATTCCTGAACAACAACTTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015833 Nonsense 361 375 1 1
Genomic Location (Zv9):
Chromosome 8 (position 53912960)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51648319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACRGGCAKCACTAAARGCTCCATCTTGAGCAACGGCTCGGCTARCACCTM[C/A]CAGCCACACAAGWAAAACAGTTTRGAACAGAAAGAGAGCATTTAAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015833 Nonsense 366 375 1 1
Genomic Location (Zv9):
Chromosome 8 (position 53912947)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51648306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AARGCTCCATCTTGAGCAACGGCTCGGCTARCACCTMCCAGCCACACAAG[A/T]AAAACAGTTTRGAACAGAAAGAGAGCATTTAAAGTACTTTTTTGACTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link