scn8aa

Ensembl ID:
ENSDARG00000005775
ZFIN ID:
ZDB-GENE-000828-1
Description:
sodium channel, voltage-gated, type VIII, alpha a [Source:RefSeq peptide;Acc:NP_571703]
Human Orthologue:
SCN8A
Human Description:
sodium channel, voltage gated, type VIII, alpha subunit [Source:HGNC Symbol;Acc:10596]
Mouse Orthologue:
Scn8a
Mouse Description:
sodium channel, voltage-gated, type VIII, alpha Gene [Source:MGI Symbol;Acc:MGI:103169]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31090 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37728 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43994 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12919 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Essential Splice Site None 1949 1 27
Genomic Location (Zv9):
Chromosome 23 (position 27585832)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27418654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGCAGTCCAGCGAGGATTTTTTGGATACCCGCTAACGCAATCATAG[T/G]AAGTATTATGTTTAAATAACGCACTGGCGATGCGTTTAGAGGTGCGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Essential Splice Site 680 1949 13 27
Genomic Location (Zv9):
Chromosome 23 (position 27530831)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27363653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGAGCAAACAGCGTGATGAGTGCGTTAACCAACACATTGGTTGAAGG[T/A]ATGTCCACATAACATAAAGGCCAATTCACACTCTACCAACAGTCACTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Essential Splice Site 1094 1949 18 27
Genomic Location (Zv9):
Chromosome 23 (position 27515948)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27348770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTACTTAAATAATTTATCTTCACAAATGTCATCTTTCTTTTTGATCA[G/A]TTGGATGACATCAGCTCTTCAGAGGGCAGCACCATAGATATTAAACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Nonsense 1655 1949 27 27
Genomic Location (Zv9):
Chromosome 23 (position 27493827)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27326649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCAAACTTTGCCTACGTGAAGCGGGAGTCTGGCATAGATGACATGTA[T/G]AACTTTGAAACATTTGGCAATAGCATGATCTGCCTGKTCATGATAACCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link