col14a1

Ensembl ID:
ENSDARG00000005762
ZFIN ID:
ZDB-GENE-030131-9889
Description:
Col14a1 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW57]
Human Orthologue:
COL14A1
Human Description:
collagen, type XIV, alpha 1 [Source:HGNC Symbol;Acc:2191]
Mouse Orthologue:
Col14a1
Mouse Description:
collagen, type XIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1341272]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11768 Splice Site, Nonsense Available for shipment Available now
sa7420 Missense Mutation detected in F1 DNA During 2016
sa11818 Essential Splice Site Available for shipment Available now
sa12938 Nonsense Available for shipment Available now
sa42688 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36074 Nonsense Mutation detected in F1 DNA During 2016
sa28616 Nonsense Mutation detected in F1 DNA During 2016
sa12349 Nonsense Available for shipment Available now
sa22787 Nonsense Available for shipment Available now
sa10929 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Splice Site, Nonsense 347 1864 8 47
ENSDART00000134087   None 1382 None 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17096689)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14911550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACYAGGACGGTGTGTGATGGAGYGGAGCAACAGGACAAAGAAATTAAA[C/T]GTGAGTRCTTATACCTAATGTAGATGTGTCATATGTGRAAAGGGATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Missense 822 1864 20 47
ENSDART00000134087 Missense 340 1382 10 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17166137)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14980998
KASP Assay ID:
554-4323.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTYATTGCTAATGCTAATAWTGGYTTTCTCTTTTCTGATTGGTTAGTGC[C/A]ACTTTCTGGCCCCAGYAACCTCAGGGTGTCTGATGAATGGTACAATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Essential Splice Site 1000 1864 23 47
ENSDART00000134087 Essential Splice Site 518 1382 13 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17196940)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15011801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTTTTWCAGGACACAGAGGGCCCTGCTGTCAYCACCATGGTCACCACTGG[T/A]AAATACACTCAGAAAAATTAAYACTATACTATTTACTTGAGWGRAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1376 1864 33 47
ENSDART00000134087 Nonsense 894 1382 23 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17268904)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15083765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTCATGTGGCCATCAGCAAAACTGCTGCTAAAGTGGTGATCGACTGC[A/T]AGACRGTTGGAGAGAAATCCATCAATGCCGCAGGGAAYATCAGCATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Essential Splice Site 1630 1864 43 47
ENSDART00000134087 Essential Splice Site 1148 1382 33 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17329641)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15144502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCTGTTCGTGCAATAGCTCGACAAGTTTGTGAACAGCTTATTCAGAG[T/C]GAGTTGACCATGTATTTTGTCTAACATTGTTCCTCATTTACTTAATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1671 1864 44 47
ENSDART00000134087 Nonsense 1189 1382 34 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17329878)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15144739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCGCCAGGTGAGCCCGGTCGGCCAGGACTTCAGGGGCCACAGGGAGAG[C/T]AGGGTCCTCCTGGCAGACCAGGATTCCCTGGAGCCAGTGGGCAAAACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1709 1864 45 47
ENSDART00000134087 Nonsense 1227 1382 35 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17332068)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15146929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTCTTCCAGGAGAAAGGGGAGAGAAGGGCAGCCCAGGTGTGGGGACA[C/T]AAGGCCCTCGTGGTCCTCCAGGATCTCCAGGTGAAAGACTGTTAAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1767 1864 46 47
ENSDART00000134087 Nonsense 1285 1382 36 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17332812)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15147673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCTGCTGGACCGCCCGGCTACTGCGACCARAAYTCCTGCCTCGGRTA[C/A]AATGTTGGAGGTAATAATCTCATTCTCTACATCTGTTTCTCAAACTNTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1791 1864 47 47
ENSDART00000134087 Nonsense 1309 1382 37 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17343320)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15158181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTCCAATCCCTACCAAAACTACGGCCCCGCCACCAACTACAACCCT[G/T]AGGATGAGGAGGAGGATGACCCTTATGGCGGCTACCGGGCCTACCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1864 1864 47 47
ENSDART00000134087 Nonsense 1382 1382 37 37
ENSDART00000137912   None 253 None 8
ENSDART00000138611   None 96 None 5
Genomic Location (Zv9):
Chromosome 16 (position 17343541)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15158402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCATCGTCCATCAGCCGCAGGAGCATGTGAAGGAAGAAGAGCTGTG[G/A]TGACCGACAGAYCGTCCACATACAAACACTTTTCAGCAKAAYGTYCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link