col14a1

Ensembl ID:
ENSDARG00000005762
ZFIN ID:
ZDB-GENE-030131-9889
Description:
Col14a1 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW57]
Human Orthologue:
COL14A1
Human Description:
collagen, type XIV, alpha 1 [Source:HGNC Symbol;Acc:2191]
Mouse Orthologue:
Col14a1
Mouse Description:
collagen, type XIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1341272]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11768 Splice Site, Nonsense Available for shipment Available now
sa7420 Missense Mutation detected in F1 DNA During 2014
sa19136 Nonsense Mutation detected in F1 DNA During 2014
sa11818 Essential Splice Site Available for shipment Available now
sa12938 Nonsense Available for shipment Available now
sa12349 Nonsense Available for shipment Available now
sa22787 Nonsense Mutation detected in F1 DNA During 2014
sa10929 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Splice Site, Nonsense 347 1864 8 47
ENSDART00000134087 None None 1382 None 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17096689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACYAGGACGGTGTGTGATGGAGYGGAGCAACAGGACAAAGAAATTAAA[C/T]GTGAGTRCTTATACCTAATGTAGATGTGTCATATGTGRAAAGGGATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Missense 822 1864 20 47
ENSDART00000134087 Missense 340 1382 10 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17166137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTYATTGCTAATGCTAATAWTGGYTTTCTCTTTTCTGATTGGTTAGTGC[C/A]ACTTTCTGGCCCCAGYAACCTCAGGGTGTCTGATGAATGGTACAATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 853 1864 20 47
ENSDART00000134087 Nonsense 371 1382 10 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17166231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCGCTTCCGCATTAGCTGGGACAGTCCTCAATTCCCCACCATGGGTTA[C/A]AGAGTCATCTATCAGCCCATCTCTGGTATGTACACTCACACACAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Essential Splice Site 1000 1864 23 47
ENSDART00000134087 Essential Splice Site 518 1382 13 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17196940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTTTTWCAGGACACAGAGGGCCCTGCTGTCAYCACCATGGTCACCACTGG[T/A]AAATACACTCAGAAAAATTAAYACTATACTATTTACTTGAGWGRAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1376 1864 33 47
ENSDART00000134087 Nonsense 894 1382 23 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17268904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTCATGTGGCCATCAGCAAAACTGCTGCTAAAGTGGTGATCGACTGC[A/T]AGACRGTTGGAGAGAAATCCATCAATGCCGCAGGGAAYATCAGCATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1767 1864 46 47
ENSDART00000134087 Nonsense 1285 1382 36 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17332812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCTGCTGGACCGCCCGGCTACTGCGACCARAAYTCCTGCCTCGGRTA[C/A]AATGTTGGAGGTAATAATCTCATTCTCTACATCTGTTTCTCAAACTNTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1791 1864 47 47
ENSDART00000134087 Nonsense 1309 1382 37 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17343320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTCCAATCCCTACCAAAACTACGGCCCCGCCACCAACTACAACCCT[G/T]AGGATGAGGAGGAGGATGACCCTTATGGCGGCTACCGGGCCTACCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027982 Nonsense 1864 1864 47 47
ENSDART00000134087 Nonsense 1382 1382 37 37
ENSDART00000137912 None None 253 None 8
ENSDART00000138611 None None 96 None 5
Genomic Location:
Chromosome 16 (position 17343541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCATCGTCCATCAGCCGCAGGAGCATGTGAAGGAAGAAGAGCTGTG[G/A]TGACCGACAGAYCGTCCACATACAAACACTTTTCAGCAKAAYGTYCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v6hadz5p