DYNC1I2 (1 of 3)

Ensembl ID:
ENSDARG00000005756
Description:
dynein, cytoplasmic 1, intermediate chain 2 [Source:HGNC Symbol;Acc:2964]
Human Orthologue:
DYNC1I2
Human Description:
dynein, cytoplasmic 1, intermediate chain 2 [Source:HGNC Symbol;Acc:2964]
Mouse Orthologue:
Dync1i2
Mouse Description:
dynein cytoplasmic 1 intermediate chain 2 Gene [Source:MGI Symbol;Acc:MGI:107750]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8920 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061835 Essential Splice Site 246 290 6 7
Genomic Location (Zv9):
Chromosome 9 (position 3214536)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3245353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGGAAAGATGTGCTCCTGGAGTCTGGACATGCTGTCTCAACCACAG[G/T]TACCCATAATGCTCTGATACAAAATCTRACACACTGGTGGGRGTWGGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link