ptprfb

Ensembl ID:
ENSDARG00000005754
ZFIN ID:
ZDB-GENE-060503-530
Description:
Receptor-type tyrosine-protein phosphatase F [Source:UniProtKB/Swiss-Prot;Acc:A4IFW2]
Human Orthologue:
PTPRF
Human Description:
protein tyrosine phosphatase, receptor type, F [Source:HGNC Symbol;Acc:9670]
Mouse Orthologue:
Ptprf
Mouse Description:
protein tyrosine phosphatase, receptor type, F Gene [Source:MGI Symbol;Acc:MGI:102695]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32883 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2047 Essential Splice Site F2 line generated During 2017
sa12334 Nonsense Available for shipment Available now
sa19723 Nonsense Available for shipment Available now
sa19722 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Essential Splice Site None 1909 1 33
ENSDART00000090341   None 1870 None 31
ENSDART00000126665   None 92 None 4
ENSDART00000133709   None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17599481)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18156810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTATTTATTTTTGAGTGGATGTTTTTTTTAATTTCATATTGTTATGG[G/A]TAAGTTTATCAAACACTTTCTGTGATCTATGATTTGTGTGACATGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2047
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Essential Splice Site 129 1909 5 33
ENSDART00000090341   95 1870 3 31
ENSDART00000126665   None 92 None 4
ENSDART00000133709   None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17499817)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18057146
KASP Assay ID:
554-2936.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCYTTTAGGCTCCTGACTTGACCTGCTTTTTTNNCTTTCTTTCTTTCTGC[A/T]GAAAATCAGATTCCGCATGGTTTCCCCACCATAGACATGGGTCCTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Nonsense 187 1909 5 33
ENSDART00000090341 Nonsense 154 1870 3 31
ENSDART00000126665   None 92 None 4
ENSDART00000133709   None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17499642)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18056971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTAAAGACTTCCTGCCWGTAGACATCAAYGGCAACGGGCGAATCAAA[C/T]AGCTTCGYTCAGGTAGACTTYCTTACATCCCTACAATCWCTGGAACAAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Nonsense 208 1909 6 33
ENSDART00000090341 Nonsense 176 1870 4 31
ENSDART00000126665   None 92 None 4
ENSDART00000133709   None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17488555)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18045884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGCAGATTGAAAACAGCGAGGAATCAGACCAGGGCAAGTACGAATG[T/A]GTGGCTACGAATAGCGCCGGGACGCGTTATTCAGCTCCGGCTAATCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Essential Splice Site 556 1909 9 33
ENSDART00000090341 Essential Splice Site 524 1870 7 31
ENSDART00000126665   None 92 None 4
ENSDART00000133709   None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17472534)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18029863
KASP Assay ID:
2259-1828.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATCAAATACGAGCTGCAATATTGGGAGGCTGACTCAGACAACAAGG[T/A]ATCATGCCAGTGCTTGTTTCTGCCCTATTCATTGAGAATTGCAAGCAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link