gpm6ba

Ensembl ID:
ENSDARG00000005739
ZFIN ID:
ZDB-GENE-030710-9
Description:
glycoprotein M6Ba [Source:RefSeq peptide;Acc:NP_982251]
Human Orthologue:
GPM6B
Human Description:
glycoprotein M6B [Source:HGNC Symbol;Acc:4461]
Mouse Orthologue:
Gpm6b
Mouse Description:
glycoprotein m6b Gene [Source:MGI Symbol;Acc:MGI:107672]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11828 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019770 Nonsense 192 289 4 7
ENSDART00000101911 Nonsense 163 260 5 8
Genomic Location:
Chromosome 1 (position 27895549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCCAATCTCACCTCTGTGGACAACATCTGTGTTGATGTGCGGCAGTA[T/A]GGTAAACACACTRACCACCCTTTTMTGTGAATTCTTTGATGTTATTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p52hsufj