si:ch211-199m3.8

Ensembl ID:
ENSDARG00000005716
ZFIN ID:
ZDB-GENE-041014-329
Description:
hypothetical protein LOC557997 [Source:RefSeq peptide;Acc:NP_001038314]
Human Orthologue:
OLFML2B
Human Description:
olfactomedin-like 2B [Source:HGNC Symbol;Acc:24558]
Mouse Orthologue:
Olfml2b
Mouse Description:
olfactomedin-like 2B Gene [Source:MGI Symbol;Acc:MGI:2443310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37083 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029620 Nonsense 196 873 4 8
ENSDART00000147068 Nonsense 196 883 4 8
Genomic Location (Zv9):
Chromosome 20 (position 33821498)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33894011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACCAGACTGAGGAGAAGTTGAACACGATTAGCACCTCTCCAAATCCA[C/T]AGCTGTCCACGTCCTCACCTACAACTCTGCCCTCAGTCATTCAGGAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
  • QT interval: Common genetic variation near the phospholamban gene is associated with cardiac repolarisation: meta-analysis of three genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link