eps8l3

Ensembl ID:
ENSDARG00000005704
ZFIN ID:
ZDB-GENE-040426-1335
Description:
EPS8-like 3 [Source:RefSeq peptide;Acc:NP_956655]
Human Orthologue:
EPS8L3
Human Description:
EPS8-like 3 [Source:HGNC Symbol;Acc:21297]
Mouse Orthologue:
Eps8l3
Mouse Description:
EPS8-like 3 Gene [Source:MGI Symbol;Acc:MGI:2139743]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11186 Nonsense Available for shipment Available now
sa14949 Essential Splice Site Available for shipment Available now
sa34404 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099512 Nonsense 20 325 2 10
ENSDART00000137242 Nonsense 20 311 2 10
ENSDART00000139682 Nonsense 20 628 3 20

The following transcripts of ENSDARG00000005704 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 26179341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTRTTGTGATTKGTATATTATAGAGGCTTYTCACCTGAGCCATCATCT[C/T]AGGGCTCTGGSATGTCTCKTCCYAGTGCTAAATCCATCTACAGTAAGTRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099512 Essential Splice Site 55 325 4 10
ENSDART00000137242 Essential Splice Site 55 311 4 10
ENSDART00000139682 Essential Splice Site 55 628 5 20

The following transcripts of ENSDARG00000005704 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 26176931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNAAGCGAGAAAAAAGTGACTGGAAATTTTCTTCTGCCTCTGTTCTCC[A/G]GCATCTGTTCACCTGTGCACTGGATGGCAGAGAGGTCAGCAGCATTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099512 Nonsense 93 325 4 10
ENSDART00000137242 Nonsense 93 311 4 10
ENSDART00000139682 Nonsense 93 628 5 20

The following transcripts of ENSDARG00000005704 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 26176815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGATTCTGGACAGTAAAGGAAAAATTTGGGGTCAAGACATGATCATA[C/T]AGATCCAGGCCAACCACCTGCAACTGTGTGACATTGAGACCAAGGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link