eps8l3

Ensembl ID:
ENSDARG00000005704
ZFIN ID:
ZDB-GENE-040426-1335
Description:
EPS8-like 3 [Source:RefSeq peptide;Acc:NP_956655]
Human Orthologue:
EPS8L3
Human Description:
EPS8-like 3 [Source:HGNC Symbol;Acc:21297]
Mouse Orthologue:
Eps8l3
Mouse Description:
EPS8-like 3 Gene [Source:MGI Symbol;Acc:MGI:2139743]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11186 Nonsense Available for shipment Available now
sa14949 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099512 Nonsense 20 325 2 10
ENSDART00000137242 Nonsense 20 311 2 10
ENSDART00000139682 Nonsense 20 628 3 20

The following transcripts of ENSDARG00000005704 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 26179341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTRTTGTGATTKGTATATTATAGAGGCTTYTCACCTGAGCCATCATCT[C/T]AGGGCTCTGGSATGTCTCKTCCYAGTGCTAAATCCATCTACAGTAAGTRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099512 Essential Splice Site 55 325 4 10
ENSDART00000137242 Essential Splice Site 55 311 4 10
ENSDART00000139682 Essential Splice Site 55 628 5 20

The following transcripts of ENSDARG00000005704 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 26176931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNAAGCGAGAAAAAAGTGACTGGAAATTTTCTTCTGCCTCTGTTCTCC[A/G]GCATCTGTTCACCTGTGCACTGGATGGCAGAGAGGTCAGCAGCATTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3f66563g