ddx19

Ensembl ID:
ENSDARG00000005699
ZFIN ID:
ZDB-GENE-020419-30
Description:
ATP-dependent RNA helicase DDX19B [Source:RefSeq peptide;Acc:NP_775365]
Human Orthologues:
DDX19A, DDX19B
Human Descriptions:
DEAD (Asp-Glu-Ala-As) box polypeptide 19A [Source:HGNC Symbol;Acc:25628]
DEAD (Asp-Glu-Ala-As) box polypeptide 19B [Source:HGNC Symbol;Acc:2742]
Mouse Orthologues:
Ddx19a, Ddx19b
Mouse Descriptions:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a Gene [Source:MGI Symbol;Acc:MGI:99526]
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b Gene [Source:MGI Symbol;Acc:MGI:2148251]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8961 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009788 Essential Splice Site 404 487 10 12
Genomic Location (Zv9):
Chromosome 11 (position 3589705)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3508209
KASP Assay ID:
2260-3843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGACGGCAAAGAGAAAGTCCTGGTTACCACTAACGTCTGTGCCAGAGG[T/C]GCATACTGMTTTATTRTAYACTATACGCTGMCTGAGGTGTCCAGCATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link