LOC561939

Ensembl ID:
ENSDARG00000005690
Human Orthologues:
SLC25A23, SLC25A41
Human Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 [Source:HGNC Symbol;A
solute carrier family 25, member 41 [Source:HGNC Symbol;Acc:28533]
Mouse Orthologues:
Slc25a23, Slc25a41
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 Gene [Source:MGI Symb
solute carrier family 25, member 41 Gene [Source:MGI Symbol;Acc:MGI:2144215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31239 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074058 Nonsense 66 472 2 11
Genomic Location (Zv9):
Chromosome 1 (position 55527707)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54310646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTGTCCTCCTCTTTCTCTGTGTATGCCCTATATTCAGCAGATTGTA[C/T]GAGCGGGAGACATCAATCACGACGGTCAGCTGGACTTCGAAGAGTTTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link