LOC561939

Ensembl ID:
ENSDARG00000005690
Human Orthologues:
SLC25A23, SLC25A41
Human Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 [Source:HGNC Symbol;A
solute carrier family 25, member 41 [Source:HGNC Symbol;Acc:28533]
Mouse Orthologues:
Slc25a23, Slc25a41
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 Gene [Source:MGI Symb
solute carrier family 25, member 41 Gene [Source:MGI Symbol;Acc:MGI:2144215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3379 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074058 Essential Splice Site 282 472 8 11
Genomic Location:
Chromosome 1 (position 55523617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTGTGTTCAGATTAAACGCTTGATGAGAGGCAGTAATGAAGGAGGAA[C/A]RCTGAAAGTTCATGAGAGATTTGTGGCTGGTTCAYTGGCTGGAGCTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aoilgxc2