S61A2_DANRE

Ensembl ID:
ENSDARG00000005675
Description:
Protein transport protein Sec61 subunit alpha-like 2 [Source:UniProtKB/Swiss-Prot;Acc:Q90YL4]
Human Orthologue:
SEC61A1
Human Description:
Sec61 alpha 1 subunit (S. cerevisiae) [Source:HGNC Symbol;Acc:18276]
Mouse Orthologue:
Sec61a1
Mouse Description:
Sec61 alpha 1 subunit (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1858417]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40769 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049425 Nonsense 465 476 12 12
Genomic Location (Zv9):
Chromosome 6 (position 42310384)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42381438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGCCGTCACTATCATCTACCAGTACTTTGAGATCTTTGTGAAGGAA[C/T]AGAGCGAAGTGGGCAGTGTGGGAGCTCTCCTGTTCTAGTATCGCCTTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link