LOC100331590

Ensembl ID:
ENSDARG00000005670
Human Orthologue:
TTBK2
Human Description:
tau tubulin kinase 2 [Source:HGNC Symbol;Acc:19141]
Mouse Orthologue:
Ttbk2
Mouse Description:
tau tubulin kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2155779]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16939 Nonsense Available for shipment Available now
sa6493 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15136 Nonsense Available for shipment Available now
sa25047 Nonsense Mutation detected in F1 DNA During 2014
sa23172 Nonsense Mutation detected in F1 DNA During 2014
sa11110 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016815 Nonsense 59 1193 2 15
Genomic Location:
Chromosome 17 (position 45409857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCYGCACCAGTGTGGCTCTGAAAGCAGAGTCYGCTCAACAACCCAAA[C/T]AGGTTCWGAAGATGGAGGTGGCGGTGTTGAAGAAACTTCAAGGCAAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016815 Essential Splice Site 201 1193 6 15
Genomic Location:
Chromosome 17 (position 45402806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAGGGGTACAGTAAGATACGCYTCGATCAACGCACACAAGAACAAGG[T/G]ACTGTAARAATCCCACRTTTACCATGTTGTTGCTTCACAATCTCATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016815 Nonsense 295 1193 9 15
Genomic Location:
Chromosome 17 (position 45402233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTCGAGAATAGTATGAGAACCTACAATGTAGTGGAAAAYGACCCATA[T/G]GATTGGGAAAGGATAAGCTCAGATAGCCCAATGACAATCACYGCAACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016815 Nonsense 822 1193 14 15
Genomic Location:
Chromosome 17 (position 45395903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCTGCTTTCCAGCTCACTAACCTTGTGAATGTTGAGGTGGATCCTT[T/A]GCTAAATGGGAATGGCCATCAGAAACCTTCAAGCCCAGTGCCAAGCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016815 Nonsense 829 1193 14 15
Genomic Location:
Chromosome 17 (position 45395883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACCTTGTGAATGTTGAGGTGGATCCTTTGCTAAATGGGAATGGCCAT[C/T]AGAAACCTTCAAGCCCAGTGCCAAGCCTGATCCCGTCTCCACGCACTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016815 Nonsense 865 1193 14 15
Genomic Location:
Chromosome 17 (position 45395775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCAGTCCGATTYTAATGAAYGGCTGTCATACGCCACCTTCAGACACA[C/T]RAAGAAATGGCAACSAGCAGCTTCAAGTACTAAAAGACCTCAACAGTGAY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c7m0tk6s