man1a1

Ensembl ID:
ENSDARG00000005652
ZFIN ID:
ZDB-GENE-041014-321
Description:
Novel protein similar to vertebrate mannosidase, alpha, class 1A, member 1 (MAN1A1) [Source:UniProtK
Human Orthologue:
MAN1A1
Human Description:
mannosidase, alpha, class 1A, member 1 [Source:HGNC Symbol;Acc:6821]
Mouse Orthologue:
Man1a
Mouse Description:
mannosidase 1, alpha Gene [Source:MGI Symbol;Acc:MGI:104677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23785 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006423 Nonsense 352 618 7 12
ENSDART00000146052 Nonsense 352 639 7 13
Genomic Location:
Chromosome 20 (position 41230215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGCAGGTAATGAACATCAGAAAAGTGCTGACTCGGCTGGACAAACCT[C/T]AAGGGTTGTACCCCAATTATCTGAACCCTAACAGTGGACAATGGGGCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b39c22tb