hrasb

Ensembl ID:
ENSDARG00000005651
ZFIN ID:
ZDB-GENE-050522-466
Description:
-Ha-ras Harvey rat sarcoma viral oncogene homolog b [Source:RefSeq peptide;Acc:NP_001018465]
Human Orthologue:
HRAS
Human Description:
v-Ha-ras Harvey rat sarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:5173]
Mouse Orthologue:
Hras1
Mouse Description:
Harvey rat sarcoma virus oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:96224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13032 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015040 Essential Splice Site 151 189 None 6

The following transcripts of ENSDARG00000005651 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 51100028)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAGAGGAAATGCCCTGATTTGTGTGTYTGTGTGTGTGTATTTCTAATT[A/T]GGGAGTGGAAGATGCCTTTTACACACTTGTTCGTGAAATCAGGCAGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fif9qrt2