robo3

Ensembl ID:
ENSDARG00000005645
ZFIN ID:
ZDB-GENE-000209-4
Description:
roundabout homolog 3 [Source:RefSeq peptide;Acc:NP_571557]
Human Orthologue:
ROBO3
Human Description:
roundabout, axon guidance receptor, homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:13433]
Mouse Orthologue:
Robo3
Mouse Description:
roundabout homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1343102]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13775 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023575 Nonsense 1297 1419 24 27
ENSDART00000024778 Nonsense 1266 1389 24 27
Genomic Location:
Chromosome 10 (position 32319239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCCTCCGCAGACCACACAYCSTCTGGGCAGAAATCCAAGRTGAAKAAG[A/T]AAGCTTCCAAGAGCGCTCAATACCGGAGAGATATACTGCAGGGCGGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0r3w7863