gcat

Ensembl ID:
ENSDARG00000005643
ZFIN ID:
ZDB-GENE-060518-3
Description:
2-amino-3-ketobutyrate coenzyme A ligase, mitochondrial [Source:RefSeq peptide;Acc:NP_001166025]
Human Orthologue:
GCAT
Human Description:
glycine C-acetyltransferase [Source:HGNC Symbol;Acc:4188]
Mouse Orthologue:
Gcat
Mouse Description:
glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase) Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40069 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007398 Nonsense 316 458 7 9
Genomic Location (Zv9):
Chromosome 3 (position 27041384)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25862852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTAATGCTTTTATTTGTTTACTATTCTCTTAGGTGGTTACACTGTT[G/T]GACCCAAGGCTTTAATTGAGCTTCTGAGACAGCGGTCTCGTCCGTACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link