fbxw5

Ensembl ID:
ENSDARG00000005642
ZFIN ID:
ZDB-GENE-040426-2571
Description:
F-box/WD repeat-containing protein 5 [Source:RefSeq peptide;Acc:NP_998484]
Human Orthologue:
FBXW5
Human Description:
F-box and WD repeat domain containing 5 [Source:HGNC Symbol;Acc:13613]
Mouse Orthologue:
Fbxw5
Mouse Description:
F-box and WD-40 domain protein 5 Gene [Source:MGI Symbol;Acc:MGI:1354731]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14998 Essential Splice Site Available for shipment Available now
sa10790 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027353 Essential Splice Site 177 597 4 11
ENSDART00000131298 Essential Splice Site 177 597 4 10
Genomic Location:
Chromosome 5 (position 62974776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGCCCACATCACTCCTCCGCTGGAGAGATTGCAGTCTTCAGTTTGGG[T/G]AGAGACAGCTWTTATATGCATTGCCCTCACACATYAACAGTAACTGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027353 Nonsense 190 597 5 11
ENSDART00000131298 Nonsense 190 597 5 10
Genomic Location:
Chromosome 5 (position 62974902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATYCGTAGACAACTACACTCTGCTGTCCCGTGTGAGAAATAAACCCTA[T/A]GATGTGTTTGGCTGCTGGCTGAATGAGACTCACCTTATTTCTGGTAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z7fl4qxx