evx1

Ensembl ID:
ENSDARG00000005628
ZFIN ID:
ZDB-GENE-980526-364
Description:
homeobox even-skipped homolog protein 1 [Source:RefSeq peptide;Acc:NP_571324]
Human Orthologue:
EVX1
Human Description:
even-skipped homeobox 1 [Source:HGNC Symbol;Acc:3506]
Mouse Orthologue:
Evx1
Mouse Description:
even skipped homeotic gene 1 homolog Gene [Source:MGI Symbol;Acc:MGI:95461]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4802 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052636 Nonsense 362 377 3 3
ENSDART00000141968 Nonsense 237 252 2 2
ENSDART00000147608 Nonsense 237 252 4 4

The following transcripts of ENSDARG00000005628 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 19184860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGGACTGAGGCCTTCCTCACTTTCTCGCCAGCAGTCATCAGCAAAT[C/A]ATCTTCGGTGTCTTTGGACCAGAGGGAGGAAGTGCCACTAACTAGATAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yjkzvpz9