tmem57a

Ensembl ID:
ENSDARG00000005625
ZFIN ID:
ZDB-GENE-040426-1097
Description:
transmembrane protein 57a [Source:RefSeq peptide;Acc:NP_956613]
Human Orthologue:
TMEM57
Human Description:
transmembrane protein 57 [Source:HGNC Symbol;Acc:25572]
Mouse Orthologue:
Tmem57
Mouse Description:
transmembrane protein 57 Gene [Source:MGI Symbol;Acc:MGI:1913396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23542 Nonsense Mutation detected in F1 DNA During 2014
sa1411 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009149 Nonsense 71 664 2 11

The following transcripts of ENSDARG00000005625 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 29788128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGCCTTTTTGGCTTTTCATCAGGAGTGTTTATGATTCCTTTAGATA[T/A]CAGGGACTGGTGAGTGTTTCATTGCTCAACTTGAGATTACACAACCGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009149 Nonsense 652 664 11 11

The following transcripts of ENSDARG00000005625 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 29816139)
KASP Assay ID:
554-1332.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGACCCCACATTACTCCTCCAAGTTCATGGACACCAGTCCTTCCAGCT[T/A]GGACCCCAATGCCTCCGTCTACCAGCCGCTCAAKAAGTGAATGTCCACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8gzphmgy