bfb

Ensembl ID:
ENSDARG00000005616
ZFIN ID:
ZDB-GENE-990415-34
Description:
complement component bfb [Source:RefSeq peptide;Acc:NP_571316]
Human Orthologues:
CFB, XXbac-BPG116M5.17
Human Descriptions:
cDNA FLJ55673, highly similar to Complement factor B [Source:UniProtKB/TrEMBL;Acc:B4E1Z4]
complement factor B [Source:HGNC Symbol;Acc:1037]
Mouse Orthologue:
Cfb
Mouse Description:
complement factor B Gene [Source:MGI Symbol;Acc:MGI:105975]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7248 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11825 Essential Splice Site Available for shipment Available now
sa18010 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003508 Essential Splice Site 20 456 1 11
ENSDART00000121732 Essential Splice Site 20 457 1 11

The following transcripts of ENSDARG00000005616 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 26838268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCGGTTAAAGTGGTTAATACTTGCACTGATATGTCCTCTCAYTRCAG[G/T]TAGGTCTTATTTACCTAATCAAGATAAATGCATTCTGAAATATAGACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003508 Essential Splice Site 209 456 None 11
ENSDART00000121732 Essential Splice Site 209 457 None 11

The following transcripts of ENSDARG00000005616 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 26837097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTCAGGATGGTRGCCAGTGGTCAGGAACAGAGCCACAGTGCTACGG[T/G]GAGTAACTGCTACAYWGAAGTTACAAAATCATATATAGACTTCTGNNNNNNGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003508 Essential Splice Site 240 456 None 11
ENSDART00000121732 None 240 457 6 11

The following transcripts of ENSDARG00000005616 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 26836803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGMTATTTTAGCATAGTCAAACACAAAYGCTGTGCTSCTTCTTTCTTC[A/G]GATCACCATGGGAAGAAAATYTWTTTGAATAAGGGTGGAAAACTTGATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pydor3ut