paxip1

Ensembl ID:
ENSDARG00000005606
ZFIN ID:
ZDB-GENE-041010-214
Description:
PAX-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5XIY8]
Human Orthologue:
PAXIP1
Human Description:
PAX interacting (with transcription-activation domain) protein 1 [Source:HGNC Symbol;Acc:8624]
Mouse Orthologue:
Paxip1
Mouse Description:
PAX interacting (with transcription-activation domain) protein 1 Gene [Source:MGI Symbol;Acc:MGI:189

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39846 Nonsense Mutation detected in F1 DNA During 2017
sa32937 Nonsense Available for shipment Available now
sa9641 Nonsense Available for shipment Available now
sa17872 Nonsense Available for shipment Available now
sa5145 Nonsense F2 line generated During 2017
sa32936 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031130 Nonsense 419 935 7 22
ENSDART00000144672 Nonsense 419 1122 7 21
Genomic Location (Zv9):
Chromosome 2 (position 29628900)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29930535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGCAACAACAGCAGCAGCAACAGTCACATCAGCTACAACAGCAACAG[C/T]AGCAGCATCAGATGGCACAACAACATCCCATGATGCTGCCACAGGTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031130 Nonsense 442 935 7 22
ENSDART00000144672 Nonsense 442 1122 7 21
Genomic Location (Zv9):
Chromosome 2 (position 29628831)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29930466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACATCCCATGATGCTGCCACAGGTCATGCAGATGCACCACCATCAA[C/T]AACAACAACAGCATCAGCCGCCGCCACAGCAACAACAGCAGCAGCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031130 Nonsense 580 935 7 22
ENSDART00000144672 Nonsense 580 1122 7 21
Genomic Location (Zv9):
Chromosome 2 (position 29628417)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29930052
KASP Assay ID:
2259-2128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAAAACAACAACAGCAGCAGCAGCAAAACCAGCAGCAGATGCACCAA[C/T]AGCATTTGCAGCAGCAACAGCATTTCCTACAACAACAACNNNTCCAACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031130 Nonsense 586 935 7 22
ENSDART00000144672 Nonsense 586 1122 7 21
Genomic Location (Zv9):
Chromosome 2 (position 29628399)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29930034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCAGCAAAACCAGCAGCAGATGCACCAAYAGCATTTGCAGCAGCAA[C/T]AGCATTTCCTACAACAACAACNNNTCCAACAGCAGCAYATGCAACAGCTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5145
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031130   None 935 19 22
ENSDART00000144672 Nonsense 1038 1122 18 21
Genomic Location (Zv9):
Chromosome 2 (position 29619928)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29921563
KASP Assay ID:
554-3520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTTNATTTTTACAGGGGAAGTATTTCTATATWACTCCAGGAATCTG[T/A]CCCAGCCTCAGCACAATGAAGCTTATAGTGGAGAGTGCCGCAGGGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031130   None 935 20 22
ENSDART00000144672 Nonsense 1098 1122 19 21
Genomic Location (Zv9):
Chromosome 2 (position 29618288)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29919923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTGAAAATGACTCTCATCTGTGCCGAGAGTATTTCCTGAAGAACATC[G/T]GTAAGATGACGCTGTTCCCATCTCAGCATTTACATTTAACACAAAACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link