bmpr1ba

Ensembl ID:
ENSDARG00000005600
ZFIN ID:
ZDB-GENE-991208-8
Description:
bone morphogenetic protein receptor type-1B [Source:RefSeq peptide;Acc:NP_571532]
Human Orthologue:
BMPR1B
Human Description:
bone morphogenetic protein receptor, type IB [Source:HGNC Symbol;Acc:1077]
Mouse Orthologue:
Bmpr1b
Mouse Description:
bone morphogenetic protein receptor, type 1B Gene [Source:MGI Symbol;Acc:MGI:107191]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13912 Nonsense Available for shipment Available now
sa20343 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 120 504 4 10
Genomic Location:
Chromosome 5 (position 8836830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTGTGYGTGCGTGCGNNNNNNNNCGNNTGCGTGCAGGTTA[T/A]GTGGTTGGAGACATTCATCATATCGCTCTGCTCATCTCWGTGAGCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 425 504 9 10
Genomic Location:
Chromosome 5 (position 8824634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAAGTGAGATGTTGTGTGTTGTTTGTGCAGGTATAGTAGAGGAGTA[T/A]CAGCTGCCGTATCATGATCATGTTCCCAATGACCCGTCATATGAAGACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4mn8rwz8