bmpr1ba

Ensembl ID:
ENSDARG00000005600
ZFIN ID:
ZDB-GENE-991208-8
Description:
bone morphogenetic protein receptor type-1B [Source:RefSeq peptide;Acc:NP_571532]
Human Orthologue:
BMPR1B
Human Description:
bone morphogenetic protein receptor, type IB [Source:HGNC Symbol;Acc:1077]
Mouse Orthologue:
Bmpr1b
Mouse Description:
bone morphogenetic protein receptor, type 1B Gene [Source:MGI Symbol;Acc:MGI:107191]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13912 Nonsense Available for shipment Available now
sa33531 Nonsense Mutation detected in F1 DNA During 2016
sa20343 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 120 504 4 10
Genomic Location:
Chromosome 5 (position 8836830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTGTGYGTGCGTGCGNNNNNNNNCGNNTGCGTGCAGGTTA[T/A]GTGGTTGGAGACATTCATCATATCGCTCTGCTCATCTCWGTGAGCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 250 504 6 10
Genomic Location:
Chromosome 5 (position 8834194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTTCACCACAGAGGAGGCCAGCTGGTTCAGGGAGACCGAGATCTA[T/A]CAGACCGTCCTCATGAGACATGACAATATACTGGGTGAGCATAACACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 425 504 9 10
Genomic Location:
Chromosome 5 (position 8824634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAAGTGAGATGTTGTGTGTTGTTTGTGCAGGTATAGTAGAGGAGTA[T/A]CAGCTGCCGTATCATGATCATGTTCCCAATGACCCGTCATATGAAGACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link