si:dkey-170m15.2

Ensembl ID:
ENSDARG00000005595
ZFIN ID:
ZDB-GENE-041001-205
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RH17]
Human Orthologue:
C6orf103
Human Description:
chromosome 6 open reading frame 103 [Source:HGNC Symbol;Acc:21212]
Mouse Orthologue:
9130014G24Rik
Mouse Description:
RIKEN cDNA 9130014G24 gene Gene [Source:MGI Symbol;Acc:MGI:3605549]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37074 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37073 Nonsense Mutation detected in F1 DNA During 2017
sa10146 Essential Splice Site Available for shipment Available now
sa18046 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Essential Splice Site 345 1471 None 35
ENSDART00000133556   None 225 None 6
ENSDART00000135492   None 716 None 17
ENSDART00000141636 Essential Splice Site 22 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32022665)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32080905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCCCTTGCACCTAATGGAGAAAAGAACCTCAATGCTCACGAGGATGG[T/A]AAGCATATGAGTTTTAATCTGCAAGTCTGCACATAAACTACTGTTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Nonsense 371 1471 10 35
ENSDART00000133556   None 225 None 6
ENSDART00000135492   None 716 None 17
ENSDART00000141636 Nonsense 48 103 2 3
Genomic Location (Zv9):
Chromosome 20 (position 32020582)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32078822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGGGCTATCTCAGCTCTTCAGTCACCCAGTGCTTCTCACCTGCACT[C/T]GAGACTGTCCTCTAGTGGCCCCTCCTAAAACACCTCCACTGCCTCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Essential Splice Site 1192 1471 None 35
ENSDART00000133556   None 225 None 6
ENSDART00000135492 Essential Splice Site 680 716 None 17
ENSDART00000141636   None 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 31975018)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32033258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTATTTTGTGAATTTGTATAATTTTGATTGTTCTGTTTGACATTGAC[A/G]GTGTTTGGAGATATTYTGGATGGCACATCTATGCCTGTGGGTACAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Nonsense 1211 1471 30 35
ENSDART00000133556   None 225 None 6
ENSDART00000135492 Nonsense 699 716 17 17
ENSDART00000141636   None 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 31974960)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32033200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATATTYTGGATGGCACATCTATGCCTGTGGGTACAGACCAACAAAAC[A/T]GAGAGGGYCAKAAATCTACTCCCAAATCAACCCACAAGGCCAAGGAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link