mtf2

Ensembl ID:
ENSDARG00000005590
ZFIN ID:
ZDB-GENE-060512-94
Description:
metal-response element-binding transcription factor 2 [Source:RefSeq peptide;Acc:NP_001038729]
Human Orthologue:
MTF2
Human Description:
metal response element binding transcription factor 2 [Source:HGNC Symbol;Acc:29535]
Mouse Orthologue:
Mtf2
Mouse Description:
metal response element binding transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:105050]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30814 Nonsense Mutation detected in F1 DNA During 2017
sa32851 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100634 Nonsense 32 285 2 10
ENSDART00000122709 Nonsense 32 605 2 15

The following transcripts of ENSDARG00000005590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10422981)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10848077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCCAAATCGCCAACACAAGTCCCCTGTGTCCTTGCCCCGATTTCCCT[T/A]GAAAGATGGGCTGACCGACACGACAAAGCTTGCTGGCAAGTTTGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100634 Nonsense 223 285 7 10
ENSDART00000122709 Nonsense 223 605 7 15

The following transcripts of ENSDARG00000005590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10407617)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10832713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTCCCACAGCTGGTATCTGAAGATGTTACAGTGTAATAAGTGTAAA[C/T]AGTGGTTTCATGAAGCTTGTATCCAGTGTTTTCAGAAGCCAATGCTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link