mphosph8

Ensembl ID:
ENSDARG00000005576
ZFIN ID:
ZDB-GENE-050309-191
Description:
Novel protein (Im:7151391) [Source:UniProtKB/TrEMBL;Acc:B0S768]
Human Orthologue:
MPHOSPH8
Human Description:
M-phase phosphoprotein 8 [Source:HGNC Symbol;Acc:29810]
Mouse Orthologue:
Mphosph8
Mouse Description:
M-phase phosphoprotein 8 Gene [Source:MGI Symbol;Acc:MGI:1922589]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8336 Nonsense Mutation detected in F1 DNA During 2014
sa18026 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056491 None None 296 None 5
ENSDART00000080404 Nonsense 403 946 3 14
ENSDART00000121939 Nonsense 380 880 5 17
ENSDART00000130529 None None 271 None 5
Genomic Location:
Chromosome 9 (position 22511918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCTGGTGACAAAGCTAGTGCCTCCAACCTCTTTGAGAAGTTCCTGT[T/A]GAACTGTGAGGCGAAAGATCGAGCACCAAGAAGACAAGYGGACCAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056491 None None 296 None 5
ENSDART00000080404 Nonsense 802 946 10 14
ENSDART00000121939 Nonsense 736 880 13 17
ENSDART00000130529 None None 271 None 5
Genomic Location:
Chromosome 9 (position 22503945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACACTGCCTTGTACTATGCCAAACTCAGTAACAATCTGATGGTGTA[T/A]GATCTGATCAAAGACCACATGCAGACGTGAGTATTTTATTGCCATATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/avtwfdul