mphosph8

Ensembl ID:
ENSDARG00000005576
ZFIN ID:
ZDB-GENE-050309-191
Description:
Novel protein (Im:7151391) [Source:UniProtKB/TrEMBL;Acc:B0S768]
Human Orthologue:
MPHOSPH8
Human Description:
M-phase phosphoprotein 8 [Source:HGNC Symbol;Acc:29810]
Mouse Orthologue:
Mphosph8
Mouse Description:
M-phase phosphoprotein 8 Gene [Source:MGI Symbol;Acc:MGI:1922589]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8336 Nonsense Mutation detected in F1 DNA During 2016
sa41402 Nonsense Mutation detected in F1 DNA During 2016
sa18026 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056491   None 296 None 5
ENSDART00000080404 Nonsense 403 946 3 14
ENSDART00000121939 Nonsense 380 880 5 17
ENSDART00000130529   None 271 None 5
Genomic Location:
Chromosome 9 (position 22511918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCTGGTGACAAAGCTAGTGCCTCCAACCTCTTTGAGAAGTTCCTGT[T/A]GAACTGTGAGGCGAAAGATCGAGCACCAAGAAGACAAGYGGACCAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056491   None 296 None 5
ENSDART00000080404 Nonsense 665 946 7 14
ENSDART00000121939 Nonsense 599 880 10 17
ENSDART00000130529   None 271 None 5
Genomic Location:
Chromosome 9 (position 22506139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTTTGACTCTTAGCCGAGCTACGAGAAGCAGTGAAGAACGGGAATTA[C/A]TTGGCGGTGAAACGTGCTCTTAGTTCAAAAGAGGACTACAATCTGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056491   None 296 None 5
ENSDART00000080404 Nonsense 802 946 10 14
ENSDART00000121939 Nonsense 736 880 13 17
ENSDART00000130529   None 271 None 5
Genomic Location:
Chromosome 9 (position 22503945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACACTGCCTTGTACTATGCCAAACTCAGTAACAATCTGATGGTGTA[T/A]GATCTGATCAAAGACCACATGCAGACGTGAGTATTTTATTGCCATATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link