entpd8

Ensembl ID:
ENSDARG00000005565
ZFIN ID:
ZDB-GENE-040724-142
Description:
ectonucleoside triphosphate diphosphohydrolase-like [Source:RefSeq peptide;Acc:NP_001002379]
Human Orthologue:
ENTPD8
Human Description:
ectonucleoside triphosphate diphosphohydrolase 8 [Source:HGNC Symbol;Acc:24860]
Mouse Orthologue:
Entpd8
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 8 Gene [Source:MGI Symbol;Acc:MGI:1919340]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40767 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33927 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011245 Essential Splice Site None 496 1 10
ENSDART00000122819   None 496 None 9
ENSDART00000125659   None 455 None 8
Genomic Location (Zv9):
Chromosome 6 (position 40970118)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41041718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTTCAATATACGGGATATACTTTGTTCATAAAGAAAGGAAAAAAGG[T/A]AAGACACTTTTGTTTCAAGGTGTGAAATCTGGTTTGAACAACAAACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011245 Essential Splice Site 185 496 6 10
ENSDART00000122819 Essential Splice Site 185 496 5 9
ENSDART00000125659 Essential Splice Site 144 455 4 8
Genomic Location (Zv9):
Chromosome 6 (position 40983043)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41054643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGATTTCTCACAAAATGTTCACCACACCTTTAATGGCTTTTTCCTGT[A/G]GCACACATTTGAGGGCTCCTGGATCCACCCTAAAGCCGGAAAGATCATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link