gfm2

Ensembl ID:
ENSDARG00000005561
ZFIN ID:
ZDB-GENE-060201-3
Description:
Ribosome-releasing factor 2, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:A0JMI9]
Human Orthologue:
GFM2
Human Description:
G elongation factor, mitochondrial 2 [Source:HGNC Symbol;Acc:29682]
Mouse Orthologue:
Gfm2
Mouse Description:
G elongation factor, mitochondrial 2 Gene [Source:MGI Symbol;Acc:MGI:2444783]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38485 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6990 Nonsense Mutation detected in F1 DNA During 2017
sa33647 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016314 Essential Splice Site 209 762 8 20

The following transcripts of ENSDARG00000005561 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 36202379)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 33984328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGACAGCATAAAGGCCAAATTAAAAGCCAACCCTGTTCTCCTTCAGG[T/G]ACTCTTTTTGAGCAACCCTTATTAAGCAACCACACTTACAAATGCAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016314 Nonsense 367 762 12 20

The following transcripts of ENSDARG00000005561 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 36204931)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 33986880
KASP Assay ID:
554-5290.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATAAAAATGATCTGTGTGCCTTGGCATTCAAAGTGGTCCATGACAAA[C/T]AGAGGGGTCCGCTTGTGTTTGTTCGRATCTATTCAGGAAGCATGAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016314 Essential Splice Site 560 762 None 20

The following transcripts of ENSDARG00000005561 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 36208691)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 33990640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAAGTGGCCTACAGAGAGACCATCCTGCAGTCAGCAACAGCCAAAGG[T/C]AACGCCAATGTAAACATTGTCTTCATATTTTGACTAACATATCACCTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link