si:dkey-202b22.4

Ensembl ID:
ENSDARG00000005547
ZFIN ID:
ZDB-GENE-041210-174
Description:
RAD50-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001038468]
Human Orthologue:
RINT1
Human Description:
RAD50 interactor 1 [Source:HGNC Symbol;Acc:21876]
Mouse Orthologue:
Rint1
Mouse Description:
RAD50 interactor 1 Gene [Source:MGI Symbol;Acc:MGI:1916233]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33450 Nonsense Available for shipment Available now
sa33449 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31393 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045639 Nonsense 162 780 3 13
Genomic Location (Zv9):
Chromosome 4 (position 17577430)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18520270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCTTTGCTTCTTTTATGCTGCATCAGTGACAGTATCCAGCAGTA[T/A]CTGATGACCAATAGTGTGTGGGATGCGGTCAGAGCCATTGACAGTATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045639 Essential Splice Site 539 780 10 13
Genomic Location (Zv9):
Chromosome 4 (position 17571733)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18514573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCCTGATGGAGATCAGAAATGCTTACTTGTATGGTATTTTGTCTCA[G/A]TTCTTCTTGCAGTTGCAGCAGGCTGCAGTTTCAGTGGGCGAGGAAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045639 Nonsense 733 780 13 13
Genomic Location (Zv9):
Chromosome 4 (position 17568573)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18511413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATCTTGACTCTAAAAGTGGGTCCGGCGCTGTTGCTATTAGACGTTT[T/A]GAAACAGTCAGAAGAAGATAGTCTTCCCAACCATCAACAGTCCAGTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link