btbd3

Ensembl ID:
ENSDARG00000005544
ZFIN ID:
ZDB-GENE-090312-7
Description:
Novel protein similar to vertebrate BTB (POZ) domain containing 3 (BTBD3) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
BTBD3
Human Description:
BTB (POZ) domain containing 3 [Source:HGNC Symbol;Acc:15854]
Mouse Orthologue:
Btbd3
Mouse Description:
BTB (POZ) domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2385155]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38296 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014970 Essential Splice Site 78 461 3 5
ENSDART00000132141 Essential Splice Site 78 263 3 5
ENSDART00000132244 Essential Splice Site 78 130 3 4
Genomic Location (Zv9):
Chromosome 1 (position 51703436)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50549933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGTGGTGGGACCTCCGGGAGGAACCCAGAGAGTGCCGGGACACAAG[G/A]TAAAAAATGACCAGCTTTGAGTCATCCCATATTTAAAAAAAAAAATACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link