xpo7

Ensembl ID:
ENSDARG00000005540
ZFIN ID:
ZDB-GENE-060628-2
Description:
exportin-7 [Source:RefSeq peptide;Acc:NP_001121702]
Human Orthologue:
XPO7
Human Description:
exportin 7 [Source:HGNC Symbol;Acc:14108]
Mouse Orthologue:
Xpo7
Mouse Description:
exportin 7 Gene [Source:MGI Symbol;Acc:MGI:1929705]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9320 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9930 Nonsense Available for shipment Available now
sa16794 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Essential Splice Site 6 1087 None 28
ENSDART00000145264 Essential Splice Site 6 1090 None 28
Genomic Location:
Chromosome 10 (position 20104149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGGAGTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGG[T/C]AAGTAAATTATTTTGTTTTGCTATTATGAAATKAATGAATTTTGATYCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Nonsense 73 1087 3 28
ENSDART00000145264 Nonsense 73 1090 3 28
Genomic Location:
Chromosome 10 (position 20109202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCGTACTCACAGTTGTTGGCTGCGAYGTGTCTCTCCAAGTTGGTGTCA[C/T]GAACWAGTAACCCCCTTCCTCTGGAGCAGCGCATTGAYATTCGTAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Nonsense 787 1087 22 28
ENSDART00000145264 Nonsense 790 1090 22 28
Genomic Location:
Chromosome 10 (position 20123680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGATYTCWGACTCACTGAATGWGTTTTTCATGAAGGTCACAGAGATTA[C/T]AGTTYGATGTGTCGTCGCCGAATGGAATCCTGCTGTTYAGGGAGACCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/85mdwk01