acy3.2

Ensembl ID:
ENSDARG00000005525
ZFIN ID:
ZDB-GENE-040718-37
Description:
Aspartoacylase-2B [Source:UniProtKB/Swiss-Prot;Acc:Q6DHQ3]
Human Orthologue:
ACY3
Human Description:
aspartoacylase (aminocyclase) 3 [Source:HGNC Symbol;Acc:24104]
Mouse Orthologue:
Acy3
Mouse Description:
aspartoacylase (aminoacylase) 3 Gene [Source:MGI Symbol;Acc:MGI:1918920]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13630 Essential Splice Site Available for shipment Available now
sa19603 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004233 Essential Splice Site None 314 None 8
ENSDART00000122217 None None 618 None 15
ENSDART00000136469 None None 186 1 5
ENSDART00000139600 None None 116 None 4

The following transcripts of ENSDARG00000005525 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 52992447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCTAAGTGGTCGCTGAAGAATGTCTTAAACTGTTAACGTGTGTGT[A/G]GGCGCATCCCCTGCAGTGCCGTGGCCCCTGCRGCTAGAATAGGCCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004233 Nonsense 224 314 7 8
ENSDART00000122217 Nonsense 528 618 14 15
ENSDART00000136469 None None 186 None 5
ENSDART00000139600 Nonsense 26 116 2 4

The following transcripts of ENSDARG00000005525 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 52987077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTGGCTTTCAGGGACCGTATTTGAAGGTGGAGATGTGGAAGCCTTC[A/T]AGATCATCAAAAGTGTGGATTATCCCAGAGATCCAGTGACTCGAAGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xggiaj4y