acy3.2

Ensembl ID:
ENSDARG00000005525
ZFIN ID:
ZDB-GENE-040718-37
Description:
Aspartoacylase-2B [Source:UniProtKB/Swiss-Prot;Acc:Q6DHQ3]
Human Orthologue:
ACY3
Human Description:
aspartoacylase (aminocyclase) 3 [Source:HGNC Symbol;Acc:24104]
Mouse Orthologue:
Acy3
Mouse Description:
aspartoacylase (aminoacylase) 3 Gene [Source:MGI Symbol;Acc:MGI:1918920]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13630 Essential Splice Site Available for shipment Available now
sa32773 Nonsense Mutation detected in F1 DNA During 2016
sa19603 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004233 Essential Splice Site None 314 None 8
ENSDART00000122217   None 618 None 15
ENSDART00000136469   None 186 1 5
ENSDART00000139600   None 116 None 4

The following transcripts of ENSDARG00000005525 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 52992447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCTAAGTGGTCGCTGAAGAATGTCTTAAACTGTTAACGTGTGTGT[A/G]GGCGCATCCCCTGCAGTGCCGTGGCCCCTGCRGCTAGAATAGGCCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004233 Nonsense 143 314 4 8
ENSDART00000122217 Nonsense 447 618 11 15
ENSDART00000136469 Nonsense 143 186 3 5
ENSDART00000139600   None 116 None 4

The following transcripts of ENSDARG00000005525 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 52988229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCATTACACAACCAGTGACTGGGCGACCCTGCACATCTGCAAATACT[T/A]ACAGGTATGAGCTTCACAAGTGTGCTTCAATAAACCCCATACTGTAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004233 Nonsense 224 314 7 8
ENSDART00000122217 Nonsense 528 618 14 15
ENSDART00000136469   None 186 None 5
ENSDART00000139600 Nonsense 26 116 2 4

The following transcripts of ENSDARG00000005525 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 52987077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTGGCTTTCAGGGACCGTATTTGAAGGTGGAGATGTGGAAGCCTTC[A/T]AGATCATCAAAAGTGTGGATTATCCCAGAGATCCAGTGACTCGAAGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link