gdf6b

Ensembl ID:
ENSDARG00000005510
ZFIN ID:
ZDB-GENE-980526-442
Description:
Growth/differentiation factor 6-B [Source:UniProtKB/Swiss-Prot;Acc:A8E7N9]
Human Orthologue:
GDF6
Human Description:
growth differentiation factor 6 [Source:HGNC Symbol;Acc:4221]
Mouse Orthologue:
Gdf6
Mouse Description:
growth differentiation factor 6 Gene [Source:MGI Symbol;Acc:MGI:95689]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43280 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36836 Nonsense Mutation detected in F1 DNA During 2017
sa23521 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022193 Essential Splice Site 117 412 2 2
Genomic Location (Zv9):
Chromosome 19 (position 23488080)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23417495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTGGATGCAGATCTAGTGTCAACAAGCATCTGTTCTCTTTGTTTCA[G/T]ATGACCATTTGAACTCTCCACTTTGGAGACAGAAATATTTATTCGACGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022193 Nonsense 120 412 2 2
Genomic Location (Zv9):
Chromosome 19 (position 23488090)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23417505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCTAGTGTCAACAAGCATCTGTTCTCTTTGTTTCAGATGACCATT[T/A]GAACTCTCCACTTTGGAGACAGAAATATTTATTCGACGTATCAACGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022193 Nonsense 127 412 2 2
Genomic Location (Zv9):
Chromosome 19 (position 23488110)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23417525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGTTCTCTTTGTTTCAGATGACCATTTGAACTCTCCACTTTGGAGA[C/T]AGAAATATTTATTCGACGTATCAACGCTTTCTGAAAATGTGGAGATCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link