LOC100329945

Ensembl ID:
ENSDARG00000005482
Human Orthologue:
RAPGEF2
Human Description:
Rap guanine nucleotide exchange factor (GEF) 2 [Source:HGNC Symbol;Acc:16854]
Mouse Orthologue:
Rapgef2
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 2 Gene [Source:MGI Symbol;Acc:MGI:2659071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22552 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003826 Essential Splice Site 176 1601 7 29
Genomic Location:
Chromosome 14 (position 50796508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGGTCAGATATGAATCTTGACACACAGTTTTGTCTGTCTCCTCATGC[A/G]GCTGCCGGCAGACTTCAGCAGGTTACACCTGGCAGACGGGATTCACCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ddmevpru