LOC100329945

Ensembl ID:
ENSDARG00000005482
Human Orthologue:
RAPGEF2
Human Description:
Rap guanine nucleotide exchange factor (GEF) 2 [Source:HGNC Symbol;Acc:16854]
Mouse Orthologue:
Rapgef2
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 2 Gene [Source:MGI Symbol;Acc:MGI:2659071]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22552 Essential Splice Site Available for shipment Available now
sa42451 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39015 Nonsense Mutation detected in F1 DNA During 2016
sa42450 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003826 Essential Splice Site 176 1601 7 29
Genomic Location (Zv9):
Chromosome 14 (position 50796508)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48873754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGGTCAGATATGAATCTTGACACACAGTTTTGTCTGTCTCCTCATGC[A/G]GCTGCCGGCAGACTTCAGCAGGTTACACCTGGCAGACGGGATTCACCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003826 Essential Splice Site 519 1601 13 29
Genomic Location (Zv9):
Chromosome 14 (position 50765843)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48843089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAATGACACATTTTCTGGAGGAGTTCGAGTACAATCTGGAGAGAGAGG[T/C]CAGTCCTTTTCTTAATGATCTACTGAGTATAGAGCCAAAGACTATAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003826 Nonsense 1040 1601 20 29
Genomic Location (Zv9):
Chromosome 14 (position 50749068)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48826314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAGCCAGAACCTGCAGCCCCCTATCATCCCACTCTTCCCCGTAATC[A/T]AGAAGGATCTCACTTTCCTGCATGAAGGTAAGGCAGTTTTTAGGGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003826 Nonsense 1573 1601 28 29
Genomic Location (Zv9):
Chromosome 14 (position 50723526)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48800772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCGCAGGGAAACCGGACCCCCGGGGCCGAGAGGAGGACGAGGCAGTG[G/T]AGGTGGAGGAGGAGGGTGAGTGCTTGTCTCCCAAACTCAGAGCTCAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link