odz3

Ensembl ID:
ENSDARG00000005479
ZFIN ID:
ZDB-GENE-990714-19
Description:
Teneurin-3 [Source:UniProtKB/Swiss-Prot;Acc:Q9W7R4]
Human Orthologue:
ODZ3
Human Description:
odz, odd Oz/ten-m homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:29944]
Mouse Orthologue:
Odz3
Mouse Description:
odd Oz/ten-m homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345183]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7384 Missense Mutation detected in F1 DNA During 2014
sa4857 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5659 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5941 Nonsense Mutation detected in F1 DNA During 2014
sa19536 Nonsense Mutation detected in F1 DNA During 2014
sa24853 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 None None 2590 None 26
ENSDART00000122700 Missense 76 2778 1 30
ENSDART00000137676 None None 2590 None 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 1 (position 39845341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGAGGCCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGARTATAGC[C/T]GCCARGKTGAGTCGCCCATGACTTCACCCMGTCCACAGGTCACATGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 None None 2590 None 26
ENSDART00000122700 Essential Splice Site 77 2778 1 30
ENSDART00000137676 None None 2590 None 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 1 (position 39845348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGARTATAGCCGCCARG[G/T]TGAGTCGCCCATGACTTCACCCMGTCCACAGGTCACATGACACAAACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Essential Splice Site 333 2590 6 26
ENSDART00000122700 Essential Splice Site 506 2778 8 30
ENSDART00000137676 Essential Splice Site 333 2590 7 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 40046996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGATTAGAATGGGATTTGATTTGTTTTGTGTGTGTGTTTTTGTGTACA[G/A]TATGACTTTGTGGAGCTGCTGGATGGCAGTCGTCTGATAGCAAAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Nonsense 779 2590 13 26
ENSDART00000122700 Nonsense 967 2778 17 30
ENSDART00000137676 Nonsense 779 2590 14 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 40095104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCAGATGGCACACCTYTGATTGGAGTCAACGTGTCCTTTGTGCACTA[T/A]CCAGACCACGGATACACCATCACACGACAGGACGGCATGTAGGTTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Nonsense 951 2590 15 26
ENSDART00000122700 Nonsense 1139 2778 19 30
ENSDART00000137676 Nonsense 951 2590 16 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 40101822)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCAGAAGTGGTTCCCTGCAGAACCCAACCTGTCATACACCTTCATCT[G/A]GGACAAAACAGACGCATACAACCAAAGAGTCTACGGCCTGTCCGAGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Essential Splice Site 1229 2590 19 26
ENSDART00000122700 Essential Splice Site 1417 2778 23 30
ENSDART00000137676 Essential Splice Site 1229 2590 20 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 40127101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATCTGCTCGCCCACTGACCTGTGATAACAGCATGCATATTGGACAG[G/A]TATATATATATATATATATATCCATACTCACTTGTTCATACTATTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Nonsense 1431 2590 20 26
ENSDART00000122700 Nonsense 1619 2778 24 30
ENSDART00000137676 Nonsense 1431 2590 21 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 40130386)
KASP Assay ID:
554-2801.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCTAATGGAACTCACCAGTATACTATGAGCTTGGTCACTGGTGATTA[T/A]AAGTACAACTTCAGCTATAGCAATGAGGACGATGTCACCGCTGTAACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tv4m6umr