nav3

Ensembl ID:
ENSDARG00000005476
ZFIN ID:
ZDB-GENE-021205-1
Description:
Neuron navigator 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5TZ18]
Human Orthologue:
NAV3
Human Description:
neuron navigator 3 [Source:HGNC Symbol;Acc:15998]
Mouse Orthologue:
Nav3
Mouse Description:
neuron navigator 3 Gene [Source:MGI Symbol;Acc:MGI:2183703]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20270 Nonsense Available for shipment Available now
sa40289 Nonsense Mutation detected in F1 DNA During 2017
sa9110 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40290 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005847 Nonsense 435 2269 8 37
ENSDART00000036886 Nonsense 267 527 4 6
ENSDART00000110767 Nonsense 409 2300 8 41
ENSDART00000143674   None 117 None 7
Genomic Location (Zv9):
Chromosome 4 (position 19838901)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21182236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCAAGCAAGTCCAACAACTGTAAGAACCACAACAATAAGTCCTTGCCA[C/T]AACCCAAAGACAAAGAGGACAAGAACAAGACCAAGAACAAAGCCAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005847 Nonsense 1572 2269 23 37
ENSDART00000036886   None 527 None 6
ENSDART00000110767 Nonsense 1575 2300 26 41
ENSDART00000143674   None 117 None 7
Genomic Location (Zv9):
Chromosome 4 (position 19901127)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21244462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTGCAGGAGTCTGAGCTGGCGGAGTTGAGAGAGACAATTGAGGCTT[T/A]GAAAACTCAGAACACAGATGCTCAGACGGCCATTCAAGTGGCCCTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005847 Essential Splice Site 1809 2269 27 37
ENSDART00000036886   None 527 None 6
ENSDART00000110767 Essential Splice Site 1813 2300 30 41
ENSDART00000143674   None 117 None 7
Genomic Location (Zv9):
Chromosome 4 (position 19910075)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21253410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGGGCTMTCGCTAAACAACCTCAACATCACCGACACCATTATGTCAGG[T/C]TAGTCCTTSCTTCATGTTWTAAAATTTTGAAGCTGTTTGGGTCTAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005847   None 2269 None 37
ENSDART00000036886   None 527 None 6
ENSDART00000110767 Essential Splice Site 2194 2300 39 41
ENSDART00000143674   None 117 None 7
Genomic Location (Zv9):
Chromosome 4 (position 19916773)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21260108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCACAGTCTGCAGCTAAAACCTTTGTTTTTTTATTTAATCATTGCTCC[A/C]GCTGTATGGTAAGAGGGCAGCATGGGAAGACCCTTCCAAATGGGTAATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link