kif5a

Ensembl ID:
ENSDARG00000005470
ZFIN ID:
ZDB-GENE-070912-141
Description:
LOC553428 protein [Source:UniProtKB/TrEMBL;Acc:Q504B9]
Human Orthologue:
KIF5A
Human Description:
kinesin family member 5A [Source:HGNC Symbol;Acc:6323]
Mouse Orthologue:
Kif5a
Mouse Description:
kinesin family member 5A Gene [Source:MGI Symbol;Acc:MGI:109564]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10562 Nonsense Available for shipment Available now
sa7168 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044227 None None 349 None 11
ENSDART00000110704 Nonsense 361 1033 11 29
Genomic Location:
Chromosome 9 (position 200668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATACGAGAAGGAGAAGGAGAAGAACAAGAGTCTGCGGGACTCCATG[C/T]AGAGGCTGGAGCTGGAGCTGCGGCGCTGGCGCAACGGTAATCACAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044227 None None 349 None 11
ENSDART00000110704 Essential Splice Site 929 1033 24 29
Genomic Location:
Chromosome 9 (position 213503)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGAGRCTGCGTTACCCACTGCGCCGSCCCAACGCCGCTCAGATCGG[T/C]ACRCTGAACACTGCATTCACATTCACACACACTCTCTCAGATCCTCTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2afjmsw3