irf2bp1

Ensembl ID:
ENSDARG00000005468
ZFIN ID:
ZDB-GENE-050420-389
Description:
Interferon regulatory factor 2-binding protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LV17]
Human Orthologue:
IRF2BP1
Human Description:
interferon regulatory factor 2 binding protein 1 [Source:HGNC Symbol;Acc:21728]
Mouse Orthologue:
Irf2bp1
Mouse Description:
interferon regulatory factor 2 binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442159]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8590 Nonsense Mutation detected in F1 DNA During 2014
sa18667 Nonsense Available for shipment Available now
sa10554 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018163 Nonsense 64 605 1 2
Genomic Location:
Chromosome 18 (position 44777778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGCTGCTCATCGACACCGCGCGGCAGCTCAAGCGGACACATGTGATG[C/T]AGGACGGCAGGTCTCCGGGTCCGCAGCCCGGCGGTAAACACGGTCCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018163 Nonsense 246 605 1 2
Genomic Location:
Chromosome 18 (position 44777230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGACGCCCTAAACCCATGCGGGATGCCCTGCACACCCTATCTGGCTG[C/A]ACMCCRTTCAATGTCCGYTTCAAGAAGGACCACGGCCTSGTGGGAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018163 Nonsense 377 605 1 2
Genomic Location:
Chromosome 18 (position 44776839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTGCTCCATGCTGCCCACTGCTCTCTGCCACATCGGCCGCCCAACA[C/T]AACCCAGAGTACGCAGACGCAAAGCATCACCTGACCCAGACGGCGCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ts7m5ohc