csnk1g2a

Ensembl ID:
ENSDARG00000005458
ZFIN ID:
ZDB-GENE-030131-6445
Description:
casein kinase 1, gamma 2a [Source:RefSeq peptide;Acc:NP_001019550]
Human Orthologue:
CSNK1G2
Human Description:
casein kinase 1, gamma 2 [Source:HGNC Symbol;Acc:2455]
Mouse Orthologue:
Csnk1g2
Mouse Description:
casein kinase 1, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:1920014]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38327 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056921 Nonsense 407 418 11 11
Genomic Location (Zv9):
Chromosome 2 (position 22535032)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23421737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTTGCATTCTCAACTCATTCACTTGTTTCAGGTGCTGTTGTTTTTTC[A/T]AGAGGAGGAAGAGGAAAGCGCTCCAGCGGCACAAGTGAGGAGGAACATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link