tacc3

Ensembl ID:
ENSDARG00000005454
ZFIN ID:
ZDB-GENE-050522-327
Description:
transforming acidic coiled-coil-containing protein 3 [Source:RefSeq peptide;Acc:NP_997746]
Human Orthologue:
TACC3
Human Description:
transforming, acidic coiled-coil containing protein 3 [Source:HGNC Symbol;Acc:11524]
Mouse Orthologue:
Tacc3
Mouse Description:
transforming, acidic coiled-coil containing protein 3 Gene [Source:MGI Symbol;Acc:MGI:1341163]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14332 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002750 Essential Splice Site 98 942 None 17
ENSDART00000122810 Essential Splice Site 98 259 None 4
ENSDART00000145884 Essential Splice Site 98 228 None 4
Genomic Location:
Chromosome 13 (position 36291234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTAATGGACAAATATGCTAAYGTGTAAAACCTCCTTTTGTGTTTTTC[A/T]GGAGTTCATTGATGAATAACACTCACACCACACCAATTGACATAGAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cb2wwg9e