tacc3

Ensembl ID:
ENSDARG00000005454
ZFIN ID:
ZDB-GENE-050522-327
Description:
transforming acidic coiled-coil-containing protein 3 [Source:RefSeq peptide;Acc:NP_997746]
Human Orthologue:
TACC3
Human Description:
transforming, acidic coiled-coil containing protein 3 [Source:HGNC Symbol;Acc:11524]
Mouse Orthologue:
Tacc3
Mouse Description:
transforming, acidic coiled-coil containing protein 3 Gene [Source:MGI Symbol;Acc:MGI:1341163]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14332 Essential Splice Site Available for shipment Available now
sa38959 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002750 Essential Splice Site 98 942 None 17
ENSDART00000122810 Essential Splice Site 98 259 None 4
ENSDART00000145884 Essential Splice Site 98 228 None 4
Genomic Location (Zv9):
Chromosome 13 (position 36291234)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35763803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTAATGGACAAATATGCTAAYGTGTAAAACCTCCTTTTGTGTTTTTC[A/T]GGAGTTCATTGATGAATAACACTCACACCACACCAATTGACATAGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002750 Essential Splice Site 879 942 15 17
ENSDART00000122810   None 259 None 4
ENSDART00000145884   None 228 None 4
Genomic Location (Zv9):
Chromosome 13 (position 36284757)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35757326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGCGTTATCAAGCTCTTAAAGCCCACGCTGAGGAGAAACTAGAACA[G/A]TATGTGCTCTGTCATGTCTCAAATGTTGCCTTACAAACTTAAAAATACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link