foxp2

Ensembl ID:
ENSDARG00000005453
ZFIN ID:
ZDB-GENE-041203-2
Description:
forkhead box protein P2 [Source:RefSeq peptide;Acc:NP_001025253]
Human Orthologue:
FOXP2
Human Description:
forkhead box P2 [Source:HGNC Symbol;Acc:13875]
Mouse Orthologue:
Foxp2
Mouse Description:
forkhead box P2 Gene [Source:MGI Symbol;Acc:MGI:2148705]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa121 Nonsense F2 line generated During 2014
sa190 Nonsense Confirmed mutation in F2 line During 2014
sa8153 Nonsense Mutation detected in F1 DNA During 2014
sa152 Nonsense Available for shipment Available now
sa13041 Essential Splice Site Available for shipment Available now
sa11787 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa121
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 67 697 2 16
ENSDART00000134820 Nonsense 67 697 7 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 5854238)
KASP Assay ID:
554-1486.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTCTCTTTTCTTTGCAGGCCCTACAAGCAGCAAGGCAATTACTCCTA[C/T]AGCAACCAGGCAGTGGCCTGAAATCTCCAAAGAACAACGACAAACAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa190
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 109 697 3 16
ENSDART00000134820 Nonsense 109 697 8 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 5844731)
KASP Assay ID:
554-0103.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGATGAGTCCACAGGTGATCACACCCCAACAGATGCAGCAGATCCTT[C/T]AACAGCAAGTCCTTTCCCCCCAGCAGCTCCAAGCCCTCTTACAACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 125 697 3 16
ENSDART00000134820 Nonsense 125 697 8 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 5844683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACAGCAAGTCCTTTCCCCCCAGCAGCTCCAAGCCCTCTTACAACAA[C/T]AACAGGCAGTCATGCTTCAGCAGGTGARCACACACAAAYACTCGCTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 353 697 8 16
ENSDART00000134820 Nonsense 353 697 13 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 5833989)
KASP Assay ID:
554-0014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATGACAGGAGTACTGCGCAGTGCCGAGTACAGATGCAGGTGGTACAA[C/T]AGCTAGAGATACAGGTACAGTAGACGCACAATTATCATCCCAAACATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 None 456 697 None 16
ENSDART00000134820 Essential Splice Site 456 697 None 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 5825554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGCGKAGACGCCACACCGACAAATACTCCATGGCCTTGTCCTCAGG[T/C]TCGAASATGTTTTTCTTTTTATTCAGAYGATGCTAAAATCAAACCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 None 506 697 12 16
ENSDART00000134820 Nonsense 506 697 17 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 5824802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTARCGCTCAACGAAATCTACAGCTGGTTCACGCGCACCTTCGCCTA[C/A]TTCCGACGYAACGCCGCCACCTGGAAGGTAATGTCCTTGCAAGGCTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ywr6t06n