gdi2

Ensembl ID:
ENSDARG00000005451
ZFIN ID:
ZDB-GENE-030131-2485
Description:
rab GDP dissociation inhibitor beta [Source:RefSeq peptide;Acc:NP_955949]
Human Orthologue:
GDI2
Human Description:
GDP dissociation inhibitor 2 [Source:HGNC Symbol;Acc:4227]
Mouse Orthologue:
Gdi2
Mouse Description:
guanosine diphosphate (GDP) dissociation inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:99845]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17800 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008584 Nonsense 387 448 10 11
Genomic Location:
Chromosome 4 (position 10539302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCARTYATTTTGCCCTTTCCACAGGTTTGTGAGCATTAGTGACCTGTA[T/A]TCGCCAACTGATGTGGGATCTGACAGCCAGGTAAATGTTWACTTGATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qacmccba