ckap5

Ensembl ID:
ENSDARG00000005446
ZFIN IDs:
ZDB-GENE-051120-174, ZDB-GENE-051120-174, ZDB-GENE-051120-174
Description:
Microtubule-associated protein 215 short isoform [Source:UniProtKB/TrEMBL;Acc:D3W653]
Human Orthologue:
CKAP5
Human Description:
cytoskeleton associated protein 5 [Source:HGNC Symbol;Acc:28959]
Mouse Orthologue:
Ckap5
Mouse Description:
cytoskeleton associated protein 5 Gene [Source:MGI Symbol;Acc:MGI:1923036]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11488 Essential Splice Site Available for shipment Available now
sa6795 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24594 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9797 Nonsense Available for shipment Available now
sa24595 Nonsense Mutation detected in F1 DNA During 2014
sa3323 Nonsense Mutation detected in F1 DNA During 2014
sa457 Essential Splice Site Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa11488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 None 19
ENSDART00000123666 None None 990 None 21
ENSDART00000127575 Essential Splice Site 326 2033 7 44
Genomic Location:
Chromosome 25 (position 5003593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAATTAGAGAGTGGAGACTATGGGGACCTGGWCCGAGCACTAAAAAAG[G/A]TAGGAGTCTTAGTGAGATTTTGGTTAATAGGGTAATCTCTGTAAGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 None 19
ENSDART00000123666 None None 990 None 21
ENSDART00000127575 Essential Splice Site 640 2033 15 44
Genomic Location:
Chromosome 25 (position 5008431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAAGATGCTGGCGAAGAAACCTGGGTGGAAAGAGACCAACTTCCAGG[T/C]AGTTCTCTTTAGTGTGATGCTGTTCATAGTTGTCTGATATTTGTTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 Essential Splice Site 60 134 2 19
ENSDART00000123666 None None 990 None 21
ENSDART00000127575 Essential Splice Site 1123 2033 26 44
Genomic Location:
Chromosome 25 (position 5017851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACCCGACACTAAGAAAGCTAAACCAGCAGGTCCTGCGGCTAAAAAGG[T/C]GTGGCACATTTCACTGTTTTCTGTTGTTGTAGGGAGTTGCTGCTAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 Nonsense 122 134 4 19
ENSDART00000123666 Nonsense 171 990 6 21
ENSDART00000127575 Nonsense 1214 2033 29 44
Genomic Location:
Chromosome 25 (position 5020259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGAACTTCATYACTCCTCGTGACGAGTACGTAGAGCAGCTCAAAACT[C/T]AAATGTCAACATGTCTGGCCAAGTGGCTACAAGACGAGCTCTTCCACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 5 19
ENSDART00000123666 Nonsense 252 990 7 21
ENSDART00000127575 Nonsense 1295 2033 30 44
Genomic Location:
Chromosome 25 (position 5020583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTGGAGTTCCTCAAGATGCTCTTCACCATGCTGAGCAGGAAAAACTA[C/A]CAGCTCAATGACTACGAGGCCTCGTCTTTCATTCCTTACCTGATCCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 7 19
ENSDART00000123666 Nonsense 316 990 9 21
ENSDART00000127575 Nonsense 1359 2033 32 44
Genomic Location:
Chromosome 25 (position 5020951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTGTANNNATGTACATTTTATTGATTTATTTTTTCACTCTTTCCAGAATG[T/A]CTCGAGGAGCTYGGCTGCCTGATTGAGAACTTCGGTATGAATGTATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa457
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 Essential Splice Site None 134 9 19
ENSDART00000123666 Essential Splice Site 435 990 11 21
ENSDART00000127575 Essential Splice Site 1478 2033 34 44
Genomic Location:
Chromosome 25 (position 5023978)
KASP Assay ID:
554-0385.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCTGTTATATGAACATAATTAATATTTTTATGTGTCCATTTTCAACA[G/A]TCAAGCTCGGCAGCAGAACGCTCACTTGGAGCAGTCGGCTCCATCCATCC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control; 24 hpf

Control; 24 hpf

zoom

Mutant; 24 hpf

Mutant; 24 hpf

zoom

Stage Entity Quality Tag
Pharyngula:Prim-5
ZFS:0000029
brain
ZFA:0000008
necrotic
PATO:0000647
abnormal
PATO:0000460

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nss4lkpo